Record detail
One row in GLEAM-DB is one paper (PubMed) × one query variant. This page shows structured labels and provenance for that record, not a final variant classification.
Record identity
- Record ID
9a0e037eb34fbd444d70ea0f- Release version
- webdb_threshold_completion_missing10_20260508
- PMID
29255295PubMed- Title
- Estimating the occurrence of primary ubiquinone deficiency by analysis of large-scale sequencing data.
- Journal
- Scientific reports
- Year
- 2017
- DOI
- 10.1038/s41598-017-17564-y
- PMC
PMC5735152PMC
Variant information
This section prioritizes normalized variant expressions where available. Non-standard source strings are not shown as canonical HGVS.
- Gene
- COQ2
- Query variant
NM_001358921.2:c.676G>T- Normalized c.HGVS
- c.676G>T
- Normalized p.HGVS
- p.(Gly226Cys)
- Representative genomic HGVS
- CM000666.1:g.84191099C>A
- Genomic HGVS aliases
- CM000666.1:g.84191099C>A; CM000666.2:g.83269946C>A; NC_000004.10:g.84410123C>A; NC_000004.11:g.84191099C>A; NC_000004.12:g.83269946C>A; NG_015825.1:g.19969G>T
CoGenEx-PM3 evidence
Evidence status is assigned at the PMID × variant level and should not be interpreted as a final variant-level pathogenicity classification.
- Evidence status
- Phase-unconfirmed biallelic evidence
- Query-evidence confidence
-
High confidence
Exact query c.HGVS was found in retained evidence.
- Phase-confirmed PM3 evidence
- No
- Phase-unconfirmed biallelic evidence
- Yes
- Other patient-level evidence
- No
- PM3 context
- Possible compound heterozygous with c.228_249delCCGCTCCTTCGCCCTGGCGCGT; c.375_376insAG; c.779-3_779delTAGG; +2 more
- PM3 evidence items
- 3
- Allelic configuration type
- Compound heterozygous candidate
Retained partner variants
c.228_249delCCGCTCCTTCGCCCTGGCGCGTc.375_376insAGc.779-3_779delTAGGp.Arg126SerfsTer47p.Ser78GlnfsTer87
Partner variants are retained structured tokens from CoGenEx-PM3 evidence items. They are not transcript-normalized in this release.
Candidate context and target validation
Candidate context windows are places selected for audit because the query or its aliases may be relevant. They are not the same as a validated match to the target c.HGVS or p.HGVS expression.
- Candidate context
- Candidate context retained: 15 text windows and 15 table windows
- Context status
- Found in final retained audit context
- Text candidate windows
- 15
- Table candidate windows
- 15
- Target c.HGVS validated
- Yes
- Target p.HGVS validated
- No
- Target validation
- Target variant matched with phase-unconfirmed biallelic evidence
Source provenance
- Reviewed source
- Supplementary material
- Supplement used by audit
- Yes
- Supplement available
- Yes
- Reviewed document format
- NXML/JATS full text
- Evidence context scope
- Expanded audit context
- Evidence location
- Supp
Source links and copyright boundary
Use the PMID, PMC and DOI links above to inspect the source publication where access is permitted. GLEAM-DB redistributes structured metadata, evidence labels and provenance fields only; it does not redistribute copyrighted full text, supplementary tables, copied source tables, long evidence contexts, raw source documents, raw LLM outputs or internal processing logs.