Search GLEAM-DB / CoGenEx-PM3

Advanced search and filters
Input query
Recognized gene
A4GALT, AARS1, AARS2, AASS, ABAT and 1 more
Normalized c.HGVS
c.*843C>T, c.-43C>T, c.109G>A, c.1182G>A (p.Met394Ile), c.1183C>T and 45 more
Normalized p.HGVS
p.(=), p.(Ala226Val), p.(Ala614Pro), p.(Ala614Ser), p.(Ala631Thr) and 33 more
Matching records
11832
PM3-positive records
249

Results are ordered by PM3-relevant evidence first. Reviewed source only indicates whether main text, supplementary material, or both were reviewed; it is not the evidence conclusion.

Download current query results as TSV
Gene Variant Evidence PM3 context Publication Reviewed source Actions
DCHS1 NM_003737.4:c.7001C>T Phase-confirmed PM3 evidence
Needs review
Confirmed in trans with p.P197L
context: Confirmed in trans
29046692
A patient with van Maldergem syndrome with endocrine abnormalities, hypogonadotropic hypogonadism, and breast aplasia/hypoplasia.
International journal of pediatric endocrinology, 2017
Main article
Open
KCNJ1 NM_153766.3:c.197T>A Phase-confirmed PM3 evidence
High confidence
Confirmed in trans with c.875G > A; Arg292Gln; p.R292Q
context: Confirmed in trans
28979772
Late-onset Bartter syndrome type II.
Clinical kidney journal, 2017
Main article
Open
TMEM67 NM_153704.6:c.641A>G Phase-confirmed PM3 evidence
High confidence
Confirmed in trans with c.622A>T; p.(Arg208Ter)
context: Confirmed in trans
28680603
Isolated congenital hepatic fibrosis associated with TMEM67 mutations: report of a new genotype-phenotype relationship.
Clinical case reports, 2017
Main article
Open
MVK NM_000431.4:c.151C>T Phase-confirmed PM3 evidence
High confidence
Confirmed in trans with c.1027C > T; p.L343P
context: Confirmed in trans
28603204
[A 6-year-old girl diagnosed with mevalonate kinase deficiency who had hydrops fetalis and neonatal-onset cholestasis].
Nihon Rinsho Men'eki Gakkai kaishi = Japanese journal of clinical immunology, 2017
Main article
Open
FGD4 NM_001370298.3:c.1715G>A Phase-confirmed PM3 evidence
High confidence
Confirmed in trans with c.1192‐48_1233del; p.(?); 90 bp deletion
context: Confirmed in trans
28543957
A novel mutation in the FGD4 gene causing Charcot-Marie-Tooth disease.
Journal of the peripheral nervous system : JPNS, 2017
Main article
Open
CYB5R3 NM_000398.7:c.775C>T Phase-confirmed PM3 evidence
High confidence
PM3 evidence identified; partner variant not structured
context: Confirmed in trans
28195434
A patient with both methemoglobinemia and G6PD deficiency: A therapeutic conundrum.
American journal of hematology, 2017
Main article
Open
SZT2 NM_001365999.1:c.8471G>A Phase-confirmed PM3 evidence
High confidence
Confirmed in trans with p.P2844L
context: Confirmed in trans
28180185
Precision therapy for a new disorder of AMPA receptor recycling due to mutations in ATAD1.
Neurology. Genetics, 2017
Supplementary material
Open
ATP7B NM_000053.4:c.2921C>T Phase-confirmed PM3 evidence
Needs review
Confirmed in trans with p.Ser391 Leu; p.Ser391Leu
context: Confirmed in trans
27935710
Quantification of ATP7B Protein in Dried Blood Spots by Peptide Immuno-SRM as a Potential Screen for Wilson's Disease.
Journal of proteome research, 2017
Main article
Open
EARS2 NM_001083614.2:c.184A>T Phase-confirmed PM3 evidence
High confidence
Confirmed in trans with c.1>G; p.Met1?
context: Confirmed in trans
27571996
Lethal Neonatal LTBL Associated with Biallelic EARS2 Variants: Case Report and Review of the Reported Neuroradiological Features.
JIMD reports, 2017
Main article
Open
ADAMTS13 NM_139027.6:c.2089G>A Phase-unconfirmed biallelic evidence
Needs review
Possible compound heterozygous with c.1874G>A; c.762_774del12pb; p.Arg625His; +2 more
context: Compound heterozygous candidate
30046676
Combined study of ADAMTS13 and complement genes in the diagnosis of thrombotic microangiopathies using next-generation sequencing.
Research and practice in thrombosis and haemostasis, 2017
Main article
Open
F7 NM_019616.4:c.1058G>A Phase-unconfirmed biallelic evidence
High confidence
Possible compound heterozygous with IVS7+7A>G; g.9733A>G
context: Compound heterozygous candidate
29876229
Molecular Characterization of Iranian Patients with Inherited Coagulation Factor VII Deficiency.
Balkan journal of medical genetics : BJMG, 2017
Main article
Open
PALB2 NM_024675.4:c.104T>C Phase-unconfirmed biallelic evidence
Needs review
Possible compound heterozygous with truncating mutation
context: Compound heterozygous candidate
29387807
Perturbation of PALB2 function by the T413S mutation found in small cell lung cancer.
Wellcome open research, 2017
Main article
Open
PALB2 NM_024675.4:c.3428T>C Phase-unconfirmed biallelic evidence
Needs review
Possible compound heterozygous with truncating mutation
context: Compound heterozygous candidate
29387807
Perturbation of PALB2 function by the T413S mutation found in small cell lung cancer.
Wellcome open research, 2017
Main article
Open
RPGRIP1L NM_015272.5:c.2952G>C Phase-unconfirmed biallelic evidence
High confidence
Possible compound heterozygous with c.196C>A; c.685G>A; p.Ala229Thr; +1 more
context: Compound heterozygous candidate
29343940
Prescreening whole exome sequencing results from patients with retinal degeneration for variants in genes associated with retinal degeneration.
Clinical ophthalmology (Auckland, N.Z.), 2017
Main article
Open
RPGRIP1L NM_015272.5:c.628A>G Phase-unconfirmed biallelic evidence
High confidence
Possible compound heterozygous with c.171G>T; p.Leu57Phe
context: Compound heterozygous candidate
29343940
Prescreening whole exome sequencing results from patients with retinal degeneration for variants in genes associated with retinal degeneration.
Clinical ophthalmology (Auckland, N.Z.), 2017
Main article
Open
B3GALNT2 NM_152490.5:c.802G>A Phase-unconfirmed biallelic evidence
Needs review
Homozygous for query variant
context: Homozygous evidence
29273094
B3GALNT2 mutations associated with non-syndromic autosomal recessive intellectual disability reveal a lack of genotype-phenotype associations in the muscular dystrophy-dystroglycanopathies.
Genome medicine, 2017
Main article
Open
TTN NM_001267550.2:c.104575C>T Phase-unconfirmed biallelic evidence
High confidence
Possible compound heterozygous with c.68770G>A; p.A22924T
context: Compound heterozygous candidate
29263846
Germline TTN variants are enriched in PTEN-wildtype Bannayan-Riley-Ruvalcaba syndrome.
NPJ genomic medicine, 2017
Main article
Open
COQ2 NM_001358921.2:c.572T>G Phase-unconfirmed biallelic evidence
High confidence
Possible compound heterozygous with c.568A>T; c.693-2A>G; c.693-4_693delTCAGT; +3 more
context: Compound heterozygous candidate
29255295
Estimating the occurrence of primary ubiquinone deficiency by analysis of large-scale sequencing data.
Scientific reports, 2017
Supplementary material
Open
COQ2 NM_001358921.2:c.676G>T Phase-unconfirmed biallelic evidence
High confidence
Possible compound heterozygous with c.228_249delCCGCTCCTTCGCCCTGGCGCGT; c.375_376insAG; c.779-3_779delTAGG; +2 more
context: Compound heterozygous candidate
29255295
Estimating the occurrence of primary ubiquinone deficiency by analysis of large-scale sequencing data.
Scientific reports, 2017
Supplementary material
Open
PDSS1 NM_014317.5:c.1138G>A Phase-unconfirmed biallelic evidence
High confidence
Possible compound heterozygous with c.300G>A; c.336+1G>A; c.409C>T; +2 more
context: Compound heterozygous candidate
29255295
Estimating the occurrence of primary ubiquinone deficiency by analysis of large-scale sequencing data.
Scientific reports, 2017
Supplementary material
Open