Search GLEAM-DB / CoGenEx-PM3

Advanced search and filters
Input query
Recognized gene
ABCA4, ATM, BRCA2, CDH23, COQ6 and 18 more
Normalized c.HGVS
c.104C>A, c.1118G>A, c.116C>T, c.1433A>G, c.1433A>T and 44 more
Normalized p.HGVS
p.(=), p.(Ala35Asp), p.(Arg1060Trp), p.(Arg1068Leu), p.(Arg1068Pro) and 44 more
Matching records
2833
PM3-positive records
56

Results are ordered by PM3-relevant evidence first. Reviewed source only indicates whether main text, supplementary material, or both were reviewed; it is not the evidence conclusion.

Download current query results as TSV
Gene Variant Evidence PM3 context Publication Reviewed source Actions
PKD1 NM_001009944.3:c.11675G>A Phase-confirmed PM3 evidence
High confidence
Confirmed in trans with c.11876C>T; Arg3959Val; p.(Ala3959Val)
context: Confirmed in trans
33168999
Biallelic inheritance of hypomorphic PKD1 variants is highly prevalent in very early onset polycystic kidney disease.
Genetics in medicine : official journal of the American College of Medical Genetics, 2021
Main article
Open
PKD1 NM_001009944.3:c.8998C>T Phase-confirmed PM3 evidence
High confidence
Confirmed in trans with c.3739A>G; p.(Met1247Val)
context: Confirmed in trans
33168999
Biallelic inheritance of hypomorphic PKD1 variants is highly prevalent in very early onset polycystic kidney disease.
Genetics in medicine : official journal of the American College of Medical Genetics, 2021
Main article
Open
IDUA NM_000203.5:c.1577T>C Phase-confirmed PM3 evidence
Needs review
Confirmed in trans with c.241C>T; p.P81S
context: Confirmed in trans
30093709
The New York pilot newborn screening program for lysosomal storage diseases: Report of the First 65,000 Infants.
Genetics in medicine : official journal of the American College of Medical Genetics, 2019
Main article
Open
IDUA NM_000203.5:c.241C>T Phase-confirmed PM3 evidence
High confidence
Confirmed in trans with c.1557T>C; p.L526P
context: Confirmed in trans
30093709
The New York pilot newborn screening program for lysosomal storage diseases: Report of the First 65,000 Infants.
Genetics in medicine : official journal of the American College of Medical Genetics, 2019
Main article
Open
PIGN NM_176787.5:c.2091_2093del Phase-unconfirmed biallelic evidence
Not assessed
Possible compound heterozygous with c.[2284–1G>C]; c.[548_549+6 del]; [Ala149_Gly212]
context: Compound heterozygous candidate
36322149
Biallelic variants in PIGN cause Fryns syndrome, multiple congenital anomalies-hypotonia-seizures syndrome, and neurologic phenotypes: A genotype-phenotype correlation study.
Genetics in medicine : official journal of the American College of Medical Genetics, 2023
Main article
Open
PIGN NM_176787.5:c.746A>G Phase-unconfirmed biallelic evidence
High confidence
Possible compound heterozygous with 2354G>A; Arg785His
context: Compound heterozygous candidate
36322149
Biallelic variants in PIGN cause Fryns syndrome, multiple congenital anomalies-hypotonia-seizures syndrome, and neurologic phenotypes: A genotype-phenotype correlation study.
Genetics in medicine : official journal of the American College of Medical Genetics, 2023
Main article
Open
LAMA2 NM_000426.4:c.5158G>C Phase-unconfirmed biallelic evidence
High confidence
Possible compound heterozygous with c.2462C>T; Thr821Met
context: Compound heterozygous candidate
33442022
Beyond diagnostic yield: prenatal exome sequencing results in maternal, neonatal, and familial clinical management changes.
Genetics in medicine : official journal of the American College of Medical Genetics, 2021
Main article
Open
PKD1 NM_001009944.3:c.5848G>A Phase-unconfirmed biallelic evidence
High confidence
Confirmed in trans with c.8362_8363insGCCAGCGAGGAGAT CGTGGCCCAGGGCAAGCGCT; p.(Ser2788Cysfs*45); Frameshift
context: Confirmed in trans
33168999
Biallelic inheritance of hypomorphic PKD1 variants is highly prevalent in very early onset polycystic kidney disease.
Genetics in medicine : official journal of the American College of Medical Genetics, 2021
Main article
Open
PKD1 NM_001009944.3:c.6484C>T Phase-unconfirmed biallelic evidence
High confidence
Confirmed in trans with 6793_6794dup; p.(Arg2266Thrfs*49)
context: Confirmed in trans
33168999
Biallelic inheritance of hypomorphic PKD1 variants is highly prevalent in very early onset polycystic kidney disease.
Genetics in medicine : official journal of the American College of Medical Genetics, 2021
Main article
Open
ENPP1 NM_006208.3:c.2330A>G Phase-unconfirmed biallelic evidence
High confidence
Possible compound heterozygous with c.1652A>G; p.(Tyr551Cys)
context: Compound heterozygous candidate
33005041
Prospective phenotyping of long-term survivors of generalized arterial calcification of infancy (GACI).
Genetics in medicine : official journal of the American College of Medical Genetics, 2021
Main article
Open
ABCA4 NM_000350.3:c.1586A>G Phase-unconfirmed biallelic evidence
High confidence
Possible compound heterozygous with c.1532G>A; p.R511H
context: Compound heterozygous candidate
32884132
A novel statistical method for interpreting the pathogenicity of rare variants.
Genetics in medicine : official journal of the American College of Medical Genetics, 2021
Supplementary material
Open
LRP5 NM_002335.4:c.3656G>A Phase-unconfirmed biallelic evidence
Needs review
Possible compound heterozygous with c.C1265T; A422V
context: Compound heterozygous candidate
32884132
A novel statistical method for interpreting the pathogenicity of rare variants.
Genetics in medicine : official journal of the American College of Medical Genetics, 2021
Supplementary material
Open
LRP5 NM_002335.4:c.4517C>T Phase-unconfirmed biallelic evidence
Needs review
Possible compound heterozygous with c.C1265T; A422V; Q368X
context: Compound heterozygous candidate
32884132
A novel statistical method for interpreting the pathogenicity of rare variants.
Genetics in medicine : official journal of the American College of Medical Genetics, 2021
Supplementary material
Open
USH2A NM_206933.4:c.6908C>T Phase-unconfirmed biallelic evidence
Needs review
Possible compound heterozygous with c.A15562G; p.C3267R; p.S5188G
context: Compound heterozygous candidate
32884132
A novel statistical method for interpreting the pathogenicity of rare variants.
Genetics in medicine : official journal of the American College of Medical Genetics, 2021
Supplementary material
Open
ALG6 NM_013339.4:c.1442A>G Phase-unconfirmed biallelic evidence
High confidence
Possible compound heterozygous with c.1465T>G; p.Phe489Val
context: Compound heterozygous candidate
32398770
Matching clinical and genetic diagnoses in autosomal dominant polycystic kidney disease reveals novel phenocopies and potential candidate genes.
Genetics in medicine : official journal of the American College of Medical Genetics, 2020
Main article
Open
ALG6 NM_013339.4:c.1465T>G Phase-unconfirmed biallelic evidence
High confidence
Possible compound heterozygous with c.1442A>G; p.Asn481Ser
context: Compound heterozygous candidate
32398770
Matching clinical and genetic diagnoses in autosomal dominant polycystic kidney disease reveals novel phenocopies and potential candidate genes.
Genetics in medicine : official journal of the American College of Medical Genetics, 2020
Main article
Open
EYS NM_001142800.2:c.4465C>T Phase-unconfirmed biallelic evidence
High confidence
Possible compound heterozygous with c.2234A>G; p.Asn745Ser
context: Compound heterozygous candidate
32037395
Copy-number variation contributes 9% of pathogenicity in the inherited retinal degenerations.
Genetics in medicine : official journal of the American College of Medical Genetics, 2020
Supplementary material
Open
EYS NM_001142800.2:c.8080A>G Phase-unconfirmed biallelic evidence
High confidence
Possible compound heterozygous with c.9354dup; p.Gln3119SerfsTer7
context: Compound heterozygous candidate
32037395
Copy-number variation contributes 9% of pathogenicity in the inherited retinal degenerations.
Genetics in medicine : official journal of the American College of Medical Genetics, 2020
Supplementary material
Open
EYS NM_001142800.2:c.9235C>G Phase-unconfirmed biallelic evidence
High confidence
Possible compound heterozygous with c.9131G>T; p.Trp3044Leu
context: Compound heterozygous candidate
32037395
Copy-number variation contributes 9% of pathogenicity in the inherited retinal degenerations.
Genetics in medicine : official journal of the American College of Medical Genetics, 2020
Supplementary material
Open
TULP1 NM_003322.6:c.1597T>C Phase-unconfirmed biallelic evidence
High confidence
Possible compound heterozygous with c.1496-6C>A; splice_region_variant&intron_variant
context: Compound heterozygous candidate
32037395
Copy-number variation contributes 9% of pathogenicity in the inherited retinal degenerations.
Genetics in medicine : official journal of the American College of Medical Genetics, 2020
Supplementary material
Open