Search GLEAM-DB / CoGenEx-PM3
Advanced search and filters
Input query
Recognized gene
ABCA4, ATM, BRCA2, CDH23, COQ6 and 18 more
Normalized c.HGVS
c.104C>A, c.1118G>A, c.116C>T, c.1433A>G, c.1433A>T and 44 more
Normalized p.HGVS
p.(=), p.(Ala35Asp), p.(Arg1060Trp), p.(Arg1068Leu), p.(Arg1068Pro) and 44 more
Matching records
2833
PM3-positive records
56
Results are ordered by PM3-relevant evidence first. Reviewed source only indicates whether main text, supplementary material, or both were reviewed; it is not the evidence conclusion.
| Gene | Variant | Evidence | PM3 context | Publication | Reviewed source | Actions |
|---|---|---|---|---|---|---|
| PKD1 |
NM_001009944.3:c.11675G>A
|
Phase-confirmed PM3 evidence
High confidence
|
Confirmed in trans with c.11876C>T; Arg3959Val; p.(Ala3959Val)
context: Confirmed in trans
|
33168999
Biallelic inheritance of hypomorphic PKD1 variants is highly prevalent in very early onset polycystic kidney disease.
Genetics in medicine : official journal of the American College of Medical Genetics, 2021
|
Main article | |
| PKD1 |
NM_001009944.3:c.8998C>T
|
Phase-confirmed PM3 evidence
High confidence
|
Confirmed in trans with c.3739A>G; p.(Met1247Val)
context: Confirmed in trans
|
33168999
Biallelic inheritance of hypomorphic PKD1 variants is highly prevalent in very early onset polycystic kidney disease.
Genetics in medicine : official journal of the American College of Medical Genetics, 2021
|
Main article | |
| IDUA |
NM_000203.5:c.1577T>C
|
Phase-confirmed PM3 evidence
Needs review
|
Confirmed in trans with c.241C>T; p.P81S
context: Confirmed in trans
|
30093709
The New York pilot newborn screening program for lysosomal storage diseases: Report of the First 65,000 Infants.
Genetics in medicine : official journal of the American College of Medical Genetics, 2019
|
Main article | |
| IDUA |
NM_000203.5:c.241C>T
|
Phase-confirmed PM3 evidence
High confidence
|
Confirmed in trans with c.1557T>C; p.L526P
context: Confirmed in trans
|
30093709
The New York pilot newborn screening program for lysosomal storage diseases: Report of the First 65,000 Infants.
Genetics in medicine : official journal of the American College of Medical Genetics, 2019
|
Main article | |
| PIGN |
NM_176787.5:c.2091_2093del
|
Phase-unconfirmed biallelic evidence
Not assessed
|
Possible compound heterozygous with c.[2284–1G>C]; c.[548_549+6 del]; [Ala149_Gly212]
context: Compound heterozygous candidate
|
36322149
Biallelic variants in PIGN cause Fryns syndrome, multiple congenital anomalies-hypotonia-seizures syndrome, and neurologic phenotypes: A genotype-phenotype correlation study.
Genetics in medicine : official journal of the American College of Medical Genetics, 2023
|
Main article | |
| PIGN |
NM_176787.5:c.746A>G
|
Phase-unconfirmed biallelic evidence
High confidence
|
Possible compound heterozygous with 2354G>A; Arg785His
context: Compound heterozygous candidate
|
36322149
Biallelic variants in PIGN cause Fryns syndrome, multiple congenital anomalies-hypotonia-seizures syndrome, and neurologic phenotypes: A genotype-phenotype correlation study.
Genetics in medicine : official journal of the American College of Medical Genetics, 2023
|
Main article | |
| LAMA2 |
NM_000426.4:c.5158G>C
|
Phase-unconfirmed biallelic evidence
High confidence
|
Possible compound heterozygous with c.2462C>T; Thr821Met
context: Compound heterozygous candidate
|
33442022
Beyond diagnostic yield: prenatal exome sequencing results in maternal, neonatal, and familial clinical management changes.
Genetics in medicine : official journal of the American College of Medical Genetics, 2021
|
Main article | |
| PKD1 |
NM_001009944.3:c.5848G>A
|
Phase-unconfirmed biallelic evidence
High confidence
|
Confirmed in trans with c.8362_8363insGCCAGCGAGGAGAT CGTGGCCCAGGGCAAGCGCT; p.(Ser2788Cysfs*45); Frameshift
context: Confirmed in trans
|
33168999
Biallelic inheritance of hypomorphic PKD1 variants is highly prevalent in very early onset polycystic kidney disease.
Genetics in medicine : official journal of the American College of Medical Genetics, 2021
|
Main article | |
| PKD1 |
NM_001009944.3:c.6484C>T
|
Phase-unconfirmed biallelic evidence
High confidence
|
Confirmed in trans with 6793_6794dup; p.(Arg2266Thrfs*49)
context: Confirmed in trans
|
33168999
Biallelic inheritance of hypomorphic PKD1 variants is highly prevalent in very early onset polycystic kidney disease.
Genetics in medicine : official journal of the American College of Medical Genetics, 2021
|
Main article | |
| ENPP1 |
NM_006208.3:c.2330A>G
|
Phase-unconfirmed biallelic evidence
High confidence
|
Possible compound heterozygous with c.1652A>G; p.(Tyr551Cys)
context: Compound heterozygous candidate
|
33005041
Prospective phenotyping of long-term survivors of generalized arterial calcification of infancy (GACI).
Genetics in medicine : official journal of the American College of Medical Genetics, 2021
|
Main article | |
| ABCA4 |
NM_000350.3:c.1586A>G
|
Phase-unconfirmed biallelic evidence
High confidence
|
Possible compound heterozygous with c.1532G>A; p.R511H
context: Compound heterozygous candidate
|
32884132
A novel statistical method for interpreting the pathogenicity of rare variants.
Genetics in medicine : official journal of the American College of Medical Genetics, 2021
|
Supplementary material | |
| LRP5 |
NM_002335.4:c.3656G>A
|
Phase-unconfirmed biallelic evidence
Needs review
|
Possible compound heterozygous with c.C1265T; A422V
context: Compound heterozygous candidate
|
32884132
A novel statistical method for interpreting the pathogenicity of rare variants.
Genetics in medicine : official journal of the American College of Medical Genetics, 2021
|
Supplementary material | |
| LRP5 |
NM_002335.4:c.4517C>T
|
Phase-unconfirmed biallelic evidence
Needs review
|
Possible compound heterozygous with c.C1265T; A422V; Q368X
context: Compound heterozygous candidate
|
32884132
A novel statistical method for interpreting the pathogenicity of rare variants.
Genetics in medicine : official journal of the American College of Medical Genetics, 2021
|
Supplementary material | |
| USH2A |
NM_206933.4:c.6908C>T
|
Phase-unconfirmed biallelic evidence
Needs review
|
Possible compound heterozygous with c.A15562G; p.C3267R; p.S5188G
context: Compound heterozygous candidate
|
32884132
A novel statistical method for interpreting the pathogenicity of rare variants.
Genetics in medicine : official journal of the American College of Medical Genetics, 2021
|
Supplementary material | |
| ALG6 |
NM_013339.4:c.1442A>G
|
Phase-unconfirmed biallelic evidence
High confidence
|
Possible compound heterozygous with c.1465T>G; p.Phe489Val
context: Compound heterozygous candidate
|
32398770
Matching clinical and genetic diagnoses in autosomal dominant polycystic kidney disease reveals novel phenocopies and potential candidate genes.
Genetics in medicine : official journal of the American College of Medical Genetics, 2020
|
Main article | |
| ALG6 |
NM_013339.4:c.1465T>G
|
Phase-unconfirmed biallelic evidence
High confidence
|
Possible compound heterozygous with c.1442A>G; p.Asn481Ser
context: Compound heterozygous candidate
|
32398770
Matching clinical and genetic diagnoses in autosomal dominant polycystic kidney disease reveals novel phenocopies and potential candidate genes.
Genetics in medicine : official journal of the American College of Medical Genetics, 2020
|
Main article | |
| EYS |
NM_001142800.2:c.4465C>T
|
Phase-unconfirmed biallelic evidence
High confidence
|
Possible compound heterozygous with c.2234A>G; p.Asn745Ser
context: Compound heterozygous candidate
|
32037395
Copy-number variation contributes 9% of pathogenicity in the inherited retinal degenerations.
Genetics in medicine : official journal of the American College of Medical Genetics, 2020
|
Supplementary material | |
| EYS |
NM_001142800.2:c.8080A>G
|
Phase-unconfirmed biallelic evidence
High confidence
|
Possible compound heterozygous with c.9354dup; p.Gln3119SerfsTer7
context: Compound heterozygous candidate
|
32037395
Copy-number variation contributes 9% of pathogenicity in the inherited retinal degenerations.
Genetics in medicine : official journal of the American College of Medical Genetics, 2020
|
Supplementary material | |
| EYS |
NM_001142800.2:c.9235C>G
|
Phase-unconfirmed biallelic evidence
High confidence
|
Possible compound heterozygous with c.9131G>T; p.Trp3044Leu
context: Compound heterozygous candidate
|
32037395
Copy-number variation contributes 9% of pathogenicity in the inherited retinal degenerations.
Genetics in medicine : official journal of the American College of Medical Genetics, 2020
|
Supplementary material | |
| TULP1 |
NM_003322.6:c.1597T>C
|
Phase-unconfirmed biallelic evidence
High confidence
|
Possible compound heterozygous with c.1496-6C>A; splice_region_variant&intron_variant
context: Compound heterozygous candidate
|
32037395
Copy-number variation contributes 9% of pathogenicity in the inherited retinal degenerations.
Genetics in medicine : official journal of the American College of Medical Genetics, 2020
|
Supplementary material | |