Search GLEAM-DB / CoGenEx-PM3

Advanced search and filters
Input query
Recognized gene
AARS1, ABCA4, ACADVL, ACOX1, ACSF3 and 13 more
Normalized c.HGVS
c.-43C>T, c.1009T>C, c.1060A>G, c.1235+5A>C, c.1438T>A and 45 more
Normalized p.HGVS
p.(=), p.(Ala549Thr), p.(Arg10Trp), p.(Arg1499Leu), p.(Arg1818Cys) and 42 more
Matching records
2840
PM3-positive records
64

Results are ordered by PM3-relevant evidence first. Reviewed source only indicates whether main text, supplementary material, or both were reviewed; it is not the evidence conclusion.

Download current query results as TSV
Gene Variant Evidence PM3 context Publication Reviewed source Actions
PKD1 NM_001009944.3:c.11675G>A Phase-confirmed PM3 evidence
High confidence
Confirmed in trans with c.11876C>T; Arg3959Val; p.(Ala3959Val)
context: Confirmed in trans
33168999
Biallelic inheritance of hypomorphic PKD1 variants is highly prevalent in very early onset polycystic kidney disease.
Genetics in medicine : official journal of the American College of Medical Genetics, 2021
Main article
Open
PKD1 NM_001009944.3:c.8998C>T Phase-confirmed PM3 evidence
High confidence
Confirmed in trans with c.3739A>G; p.(Met1247Val)
context: Confirmed in trans
33168999
Biallelic inheritance of hypomorphic PKD1 variants is highly prevalent in very early onset polycystic kidney disease.
Genetics in medicine : official journal of the American College of Medical Genetics, 2021
Main article
Open
IDUA NM_000203.5:c.1577T>C Phase-confirmed PM3 evidence
Needs review
Confirmed in trans with c.241C>T; p.P81S
context: Confirmed in trans
30093709
The New York pilot newborn screening program for lysosomal storage diseases: Report of the First 65,000 Infants.
Genetics in medicine : official journal of the American College of Medical Genetics, 2019
Main article
Open
IDUA NM_000203.5:c.241C>T Phase-confirmed PM3 evidence
High confidence
Confirmed in trans with c.1557T>C; p.L526P
context: Confirmed in trans
30093709
The New York pilot newborn screening program for lysosomal storage diseases: Report of the First 65,000 Infants.
Genetics in medicine : official journal of the American College of Medical Genetics, 2019
Main article
Open
BCKDK NM_005881.4:c.847G>A Phase-confirmed PM3 evidence
High confidence
Confirmed in trans with deletion in trans; deletion on 16p which includes this gene
context: Confirmed in trans
29907797
A comprehensive iterative approach is highly effective in diagnosing individuals who are exome negative.
Genetics in medicine : official journal of the American College of Medical Genetics, 2019
Supplementary material
Open
LZTR1 NM_006767.4:c.2089C>T Phase-confirmed PM3 evidence
Needs review
Confirmed in trans with c.2407-2A>G
context: Confirmed in trans
29469822
Autosomal recessive Noonan syndrome associated with biallelic LZTR1 variants.
Genetics in medicine : official journal of the American College of Medical Genetics, 2018
Supplementary material
Open
PIGN NM_176787.5:c.2091_2093del Phase-unconfirmed biallelic evidence
Not assessed
Possible compound heterozygous with c.[2284–1G>C]; c.[548_549+6 del]; [Ala149_Gly212]
context: Compound heterozygous candidate
36322149
Biallelic variants in PIGN cause Fryns syndrome, multiple congenital anomalies-hypotonia-seizures syndrome, and neurologic phenotypes: A genotype-phenotype correlation study.
Genetics in medicine : official journal of the American College of Medical Genetics, 2023
Main article
Open
PIGN NM_176787.5:c.746A>G Phase-unconfirmed biallelic evidence
High confidence
Possible compound heterozygous with 2354G>A; Arg785His
context: Compound heterozygous candidate
36322149
Biallelic variants in PIGN cause Fryns syndrome, multiple congenital anomalies-hypotonia-seizures syndrome, and neurologic phenotypes: A genotype-phenotype correlation study.
Genetics in medicine : official journal of the American College of Medical Genetics, 2023
Main article
Open
GAA NM_000152.5:c.-32-13T>G Phase-unconfirmed biallelic evidence
Needs review
Homozygous for query variant
context: Homozygous evidence
34906458
The ACMG SF v3.0 gene list increases returnable variant detection by 22% when compared with v2.0 in the ClinSeq cohort.
Genetics in medicine : official journal of the American College of Medical Genetics, 2022
Main article
Open
ACADVL NM_000018.4:c.65C>T Phase-unconfirmed biallelic evidence
Needs review
Homozygous for query variant
context: Homozygous evidence
33495527
Impact of newborn screening on the reported incidence and clinical outcomes associated with medium- and long-chain fatty acid oxidation disorders.
Genetics in medicine : official journal of the American College of Medical Genetics, 2021
Main article
Open
LAMA2 NM_000426.4:c.5158G>C Phase-unconfirmed biallelic evidence
High confidence
Possible compound heterozygous with c.2462C>T; Thr821Met
context: Compound heterozygous candidate
33442022
Beyond diagnostic yield: prenatal exome sequencing results in maternal, neonatal, and familial clinical management changes.
Genetics in medicine : official journal of the American College of Medical Genetics, 2021
Main article
Open
PKD1 NM_001009944.3:c.5848G>A Phase-unconfirmed biallelic evidence
High confidence
Confirmed in trans with c.8362_8363insGCCAGCGAGGAGAT CGTGGCCCAGGGCAAGCGCT; p.(Ser2788Cysfs*45); Frameshift
context: Confirmed in trans
33168999
Biallelic inheritance of hypomorphic PKD1 variants is highly prevalent in very early onset polycystic kidney disease.
Genetics in medicine : official journal of the American College of Medical Genetics, 2021
Main article
Open
PKD1 NM_001009944.3:c.6484C>T Phase-unconfirmed biallelic evidence
High confidence
Confirmed in trans with 6793_6794dup; p.(Arg2266Thrfs*49)
context: Confirmed in trans
33168999
Biallelic inheritance of hypomorphic PKD1 variants is highly prevalent in very early onset polycystic kidney disease.
Genetics in medicine : official journal of the American College of Medical Genetics, 2021
Main article
Open
ENPP1 NM_006208.3:c.2330A>G Phase-unconfirmed biallelic evidence
High confidence
Possible compound heterozygous with c.1652A>G; p.(Tyr551Cys)
context: Compound heterozygous candidate
33005041
Prospective phenotyping of long-term survivors of generalized arterial calcification of infancy (GACI).
Genetics in medicine : official journal of the American College of Medical Genetics, 2021
Main article
Open
ABCA4 NM_000350.3:c.1586A>G Phase-unconfirmed biallelic evidence
High confidence
Possible compound heterozygous with c.1532G>A; p.R511H
context: Compound heterozygous candidate
32884132
A novel statistical method for interpreting the pathogenicity of rare variants.
Genetics in medicine : official journal of the American College of Medical Genetics, 2021
Supplementary material
Open
LRP5 NM_002335.4:c.3656G>A Phase-unconfirmed biallelic evidence
High confidence
Possible compound heterozygous with c.C1265T; A422V
context: Compound heterozygous candidate
32884132
A novel statistical method for interpreting the pathogenicity of rare variants.
Genetics in medicine : official journal of the American College of Medical Genetics, 2021
Supplementary material
Open
LRP5 NM_002335.4:c.4517C>T Phase-unconfirmed biallelic evidence
High confidence
Possible compound heterozygous with c.C1265T; A422V; Q368X
context: Compound heterozygous candidate
32884132
A novel statistical method for interpreting the pathogenicity of rare variants.
Genetics in medicine : official journal of the American College of Medical Genetics, 2021
Supplementary material
Open
USH2A NM_206933.4:c.6908C>T Phase-unconfirmed biallelic evidence
High confidence
Possible compound heterozygous with c.A15562G; p.C3267R; p.S5188G
context: Compound heterozygous candidate
32884132
A novel statistical method for interpreting the pathogenicity of rare variants.
Genetics in medicine : official journal of the American College of Medical Genetics, 2021
Supplementary material
Open
ALG6 NM_013339.4:c.1442A>G Phase-unconfirmed biallelic evidence
High confidence
Possible compound heterozygous with c.1465T>G; p.Phe489Val
context: Compound heterozygous candidate
32398770
Matching clinical and genetic diagnoses in autosomal dominant polycystic kidney disease reveals novel phenocopies and potential candidate genes.
Genetics in medicine : official journal of the American College of Medical Genetics, 2020
Main article
Open
ALG6 NM_013339.4:c.1465T>G Phase-unconfirmed biallelic evidence
High confidence
Possible compound heterozygous with c.1442A>G; p.Asn481Ser
context: Compound heterozygous candidate
32398770
Matching clinical and genetic diagnoses in autosomal dominant polycystic kidney disease reveals novel phenocopies and potential candidate genes.
Genetics in medicine : official journal of the American College of Medical Genetics, 2020
Main article
Open